Journal: iScience

Article Title: A mechanistic basis for the malignant progression of salivary gland tumors

doi: 10.1016/j.isci.2021.103508

Figure Lengend Snippet: Key resources table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken polyclonal anti-GFP Abcam Ab13970; RRID: AB_300798 Rabbit monoclonal anti-E-cadherin (clone 24E10) Cell Signaling Technology 3195; RRID: AB_2291471 Goat polyclonal anti-HMGA2 R&D Systems AF3184 Goat polyclonal anti-SOX2 R&D Systems AF2018; RRID: AB_355110 Mouse monoclonal anti-Vimentin Developmental Studies Hybridoma Bank 40E-C; RRID: AB_528504 Rabbit polyclonal anti-Aquaporin 5 Millipore AB15858; RRID: AB_992731 Rat monoclonal anti-Keratin 19 Developmental Studies Hybridoma Bank TROMA-III; RRID: AB_2133570 Rabbit polyclonal anti-Active Caspase-3 R&D Systems AF835; RRID: AB_2243952 Rat monoclonal anti-integrin α6 (clone GoH3) BD Biosciences 555734; RRID: AB_2296273 Chemicals, peptides, and recombinant proteins 5-ethynyl-2’-deoxyuridine (EdU) ThermoFisher Scientific A10044 Tamoxifen Sigma T5648 Critical commercial assays Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye ThermoFisher Scientific C10337 Experimental models: Cell lines Lenti-X 293T cell line Takara/Clontech 632180 Experimental models: Organisms/strains Tg(tetO-HRAS)65Lc NCI Mouse Repository Stock No. 01XB4 Gt(ROSA)26Sor tm1(EYFP)Cos The Jackson Laboratory Stock No. 006148 Recombinant DNA pMD2.G Dr. Didier Trono Addgene #12259 psPAX2 Dr. Didier Trono Addgene #12260 pMB80 (R26-CreER) Dr. Tyler Jacks Addgene #12168 pmScarlet-i_C1 Dr. Dorus Gadella Addgene #85044 pLKO-PGK-rtTA-P2A-Cre This paper n/a pLKO-PGK-rtTA-P2A-Cre-SBE-NLS-mScarlet-I Taniguchi et al., 2020 n/a pLKO-PGK-rtTA-SBE-NLS-mScarlet-I-P2A-CreER This paper n/a Software and algorithms Fiji https://fiji.sc/ GraphPad Prism 9 GraphPad Software, LLC www.graphpad.com Other The Vevo2100 High-Resolution Micro-Imaging System FUJIFILM VisualSonics VS-20047 Nanoject III Auto-nanoliter injector Drummond Scientific Company 3-000-207 Open in a separate window Key resources table

Techniques: Recombinant, Imaging, Software

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Levels of Nrp1 and Nrp2 mRNA expression in freshly isolated Tw2+ cells vs Pax7+ cells, as determined by RNA-seq. (B) Western blot of NRP1 protein levels in cultured Tw2-derived myoblasts (Tw2-MB) and Pax7-derived myoblasts (Pax7-MB). GAPDH serves as a loading control. (C) Levels of Nrp1 and Nrp2 mRNA expression in Twist2-overexpressing Tw2-MB (Tw2-DM) and GFP-infected Tw2-MB (GFP-DM) after 4 days in differentiation medium, as determined by RNA-seq. (D) Genome browser shot of Twist2 binding at the Nrp1 promoter in both growth media (GM) and differentiation media (DM). (E) (Top panel) Co-immunostaining of Nrp1 (green), Twist2 (red), and Hoechst (blue) in adult mouse transverse section of quadriceps muscle. (Bottom panel) Zoomed in image of top panel. Scale: 50 µm. See also Figure S1

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Expressing, Isolation, RNA Sequencing Assay, Western Blot, Cell Culture, Derivative Assay, Infection, Binding Assay, Immunostaining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Overexpression of Nrp1 increases repulsion of Tw2-MB from Sema3a stripes. (Top) Control Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. (Bottom) Nrp1-overexpressing Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. (C) Overexpression of Nrp1 resulted in repulsion of Pax7-MB from Sema3a stripes. (Top) Control-infected Pax7-MB (red) were seeded on Sema3a stripes (green) and analyzed 1 day after seeding. (Bottom) Nrp1-overexpresssing Pax7-MB (red) were seeded on Sema3a stripes (green). Cells were analyzed 1 day after seeding and co-stained with Hoechst (blue). Scale bar: 100 µm. (D) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4C. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. **: p <0.005. See also Figure S4. Source data for 4B and 4C are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Over Expression, Staining, Infection

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Knockdown of Nrp1 by shRNA in Tw2-MB (red) abolished Sema3a avoidance. (Top) Control shRNA (shCtrl) infected Tw2-MB 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Tw2-MB overexpressing either shNrp1–1 or shNrp1–2 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. ***: p < 0.0005, ****: p < 0.00005. (C) Western blot showing loss of NRP1 protein in Tw2-MB infected with sgRNAs targeting Nrp1. GAPDH was used as a loading control. (D) (Top) Control pLentiCrisprV2-infected Tw2-MB (red) 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Two separate Nrp1 sgRNA-infected Tw2-MB (sgNrp1–2 and sgNrp1–5) 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (E) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5D. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. See also Figure S5. Source data for 5B and E are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: shRNA, Infection, Staining, Western Blot

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Experimental scheme for chimeric fusion assay. Tw2-MB were infected with retroviruses expressing shNrp1–2, control empty vector, or Nrp1, and mixed with primary myoblasts (SCs) infected with retroviruses expressing Sema3a-EGFP in equal numbers. Cells were then differentiated for 7 days. (B) SCs over-expressing Sema3a (green) were mixed with Tw2-MB (tdTO+) infected with Nrp1 (top), control empty vector (middle), or shNrp1–2 (bottom) retroviruses and differentiated for 7 days. Cells were fixed and stained with Hoechst (blue) and an antibody against fast myosin (MY32; white). Arrow indicates chimeric myotubes that are both Sema3a+ and tdTO+; * represents myotubes that Sema3a+ only; and arrowhead represents myotubes that are tdTO+ only. Scale bar: 50 µm. (C) Quantification of percent of nuclei in chimeric fibers for Figure 6B. Percent of nuclei in chimeric fibers was calculated as the percent of the number of nuclei in chimeric fibers over the total number of nuclei (red-only, green-only, and chimeric myofibers). Three fields per sample per experiment were quantified. Three separate experiments were performed. *: p < 0.05, **: p < 0.005. See also Figure S6. Source data for 6C is provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Single Vesicle Fusion Assay, Infection, Expressing, Plasmid Preparation, Staining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: KEY RESOURCE TABLE

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Recombinant, Isolation, Transgenic Assay, Software